Transcript: Mouse NM_175434.3

Mus musculus solute carrier family 35, member F3 (Slc35f3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc35f3 (210027)
Length:
2784
CDS:
208..1473

Additional Resources:

NCBI RefSeq record:
NM_175434.3
NBCI Gene record:
Slc35f3 (210027)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175434.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069419 CCTGTACTTACACGCAATAAA pLKO.1 705 CDS 100% 15.000 21.000 N Slc35f3 n/a
2 TRCN0000069421 CCATTGTACTACGCAGGACAT pLKO.1 544 CDS 100% 4.050 5.670 N Slc35f3 n/a
3 TRCN0000069420 CCTGTAAATGCAGTGGTCGAT pLKO.1 1225 CDS 100% 2.640 2.112 N Slc35f3 n/a
4 TRCN0000069422 CACCAGTCAGATAGTCTTCAA pLKO.1 1251 CDS 100% 4.950 3.465 N Slc35f3 n/a
5 TRCN0000069418 GCTGCAACAAATCATTTGTTT pLKO.1 761 CDS 100% 0.563 0.394 N Slc35f3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175434.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000481608 GTGAGTGGACTAAGCCAATCTCCT pLX_317 32.8% 87.4% 91.6% V5 (many diffs) n/a
2 ccsbBroadEn_14403 pDONR223 100% 87.3% 91.4% None (many diffs) n/a
3 ccsbBroad304_14403 pLX_304 0% 87.3% 91.4% V5 (many diffs) n/a
Download CSV