Transcript: Mouse NM_175460.3

Mus musculus nicotinamide nucleotide adenylyltransferase 2 (Nmnat2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nmnat2 (226518)
Length:
4548
CDS:
9..932

Additional Resources:

NCBI RefSeq record:
NM_175460.3
NBCI Gene record:
Nmnat2 (226518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175460.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111475 CCCTTCTGATAGGACACTATA pLKO.1 1394 3UTR 100% 13.200 18.480 N Nmnat2 n/a
2 TRCN0000111478 CCAGCCAGTCATCGATTACAT pLKO.1 875 CDS 100% 5.625 7.875 N Nmnat2 n/a
3 TRCN0000035443 GCCCATTTACCAGAACAGCAA pLKO.1 413 CDS 100% 2.640 3.696 N NMNAT2 n/a
4 TRCN0000111476 CCCATCACTAAAGGGCACATT pLKO.1 63 CDS 100% 4.950 3.960 N Nmnat2 n/a
5 TRCN0000111479 GCAGATATGGAAGTGATTGTT pLKO.1 654 CDS 100% 5.625 3.938 N Nmnat2 n/a
6 TRCN0000111477 CCCATTTACCAGAACAGCAAT pLKO.1 414 CDS 100% 4.950 3.465 N Nmnat2 n/a
7 TRCN0000035440 GCCAGGGATTATCTGCACAAA pLKO.1 99 CDS 100% 4.950 3.465 N NMNAT2 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1488 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175460.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02716 pDONR223 100% 85% 89.1% None (many diffs) n/a
2 ccsbBroad304_02716 pLX_304 0% 85% 89.1% V5 (many diffs) n/a
3 TRCN0000471818 TCAATGTATACTGCAGATACCCGA pLX_317 49% 85% 89.1% V5 (many diffs) n/a
Download CSV