Transcript: Mouse NM_175465.6

Mus musculus SEC14 and spectrin domains 1 (Sestd1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sestd1 (228071)
Length:
8951
CDS:
54..2144

Additional Resources:

NCBI RefSeq record:
NM_175465.6
NBCI Gene record:
Sestd1 (228071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175465.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244162 ATTACAGCAGCGTCGATTTAA pLKO_005 710 CDS 100% 15.000 21.000 N SESTD1 n/a
2 TRCN0000197587 CGACGGAACTGAACAATATTT pLKO.1 2009 CDS 100% 15.000 21.000 N Sestd1 n/a
3 TRCN0000217520 GAATTACAGCAGCGTCGATTT pLKO.1 708 CDS 100% 10.800 15.120 N Sestd1 n/a
4 TRCN0000177304 GCAAGGATGTAACTATTGAAA pLKO.1 1414 CDS 100% 5.625 7.875 N Sestd1 n/a
5 TRCN0000176516 CCAGGTGATGTAGGATATTTA pLKO.1 2504 3UTR 100% 15.000 10.500 N Sestd1 n/a
6 TRCN0000217424 GACTTGGCTTTGAGGTTATTT pLKO.1 409 CDS 100% 15.000 10.500 N Sestd1 n/a
7 TRCN0000244161 GACTTGGCTTTGAGGTTATTT pLKO_005 409 CDS 100% 15.000 10.500 N SESTD1 n/a
8 TRCN0000216904 GAATTGTAAGGAGGGTTAATC pLKO.1 2789 3UTR 100% 13.200 9.240 N Sestd1 n/a
9 TRCN0000197937 GCATTCCAAGTGAGAAATGTA pLKO.1 208 CDS 100% 5.625 3.938 N Sestd1 n/a
10 TRCN0000178095 GCTATTGCCTTTCACTCCAAT pLKO.1 1863 CDS 100% 4.950 3.465 N Sestd1 n/a
11 TRCN0000177052 GCTCTGATTAACAATGGAAGT pLKO.1 585 CDS 100% 4.050 2.835 N Sestd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175465.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09314 pDONR223 100% 88.7% 98.1% None (many diffs) n/a
2 ccsbBroad304_09314 pLX_304 0% 88.7% 98.1% V5 (many diffs) n/a
Download CSV