Transcript: Human NM_175614.5

Homo sapiens NADH:ubiquinone oxidoreductase subunit A11 (NDUFA11), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
NDUFA11 (126328)
Length:
575
CDS:
83..508

Additional Resources:

NCBI RefSeq record:
NM_175614.5
NBCI Gene record:
NDUFA11 (126328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175614.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221376 GTTGGACAATACACGTTCACT pLKO.1 248 CDS 100% 3.000 4.200 N NDUFA11 n/a
2 TRCN0000221373 CGCACGCACAACTACGGGATT pLKO.1 392 CDS 100% 1.350 1.890 N NDUFA11 n/a
3 TRCN0000417774 GAGTGGCTAAGGTTGGACAAT pLKO_005 237 CDS 100% 4.950 3.465 N NDUFA11 n/a
4 TRCN0000221372 GCCTACAGAGTCACACTCAAT pLKO.1 194 CDS 100% 4.950 3.465 N NDUFA11 n/a
5 TRCN0000221374 GCCTGCGTGTACTTTGGCATA pLKO.1 422 CDS 100% 4.050 2.835 N NDUFA11 n/a
6 TRCN0000221375 CCTTCCTTGAAGGAGTGGCTA pLKO.1 225 CDS 100% 2.640 1.848 N NDUFA11 n/a
7 TRCN0000417162 ACTCAATCCTCCGGGCACCTT pLKO_005 208 CDS 100% 0.880 0.616 N NDUFA11 n/a
8 TRCN0000413945 GAACTACTTCCTCGGTGGCTG pLKO_005 346 CDS 100% 0.720 0.504 N NDUFA11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175614.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04813 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04813 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481006 CCTGGTGTGTGGGCTGCCTCATCG pLX_317 71.7% 100% 100% V5 n/a
Download CSV