Transcript: Mouse NM_175628.3

Mus musculus alpha-2-macroglobulin (A2m), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
A2m (232345)
Length:
4687
CDS:
117..4541

Additional Resources:

NCBI RefSeq record:
NM_175628.3
NBCI Gene record:
A2m (232345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175628.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080503 CCAGGCTCATTATATTCTAAA pLKO.1 1562 CDS 100% 13.200 10.560 N A2m n/a
2 TRCN0000080507 CCTAAAGGATATGGGCTTAAA pLKO.1 2147 CDS 100% 13.200 10.560 N A2m n/a
3 TRCN0000080504 CGGGTTACCAAAGACAATTAA pLKO.1 3145 CDS 100% 15.000 10.500 N A2m n/a
4 TRCN0000080506 CCTCCAGACATCCTTGAAATA pLKO.1 4085 CDS 100% 13.200 9.240 N A2m n/a
5 TRCN0000080505 CCTCCTGTTCAACCACCTAAA pLKO.1 281 CDS 100% 10.800 7.560 N A2m n/a
6 TRCN0000006654 CCATAGTGAAAGTCTATGATT pLKO.1 4450 CDS 100% 0.563 0.338 N A2M n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175628.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.