Transcript: Mouse NM_175638.3

Mus musculus WNK lysine deficient protein kinase 4 (Wnk4), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Wnk4 (69847)
Length:
4148
CDS:
106..3774

Additional Resources:

NCBI RefSeq record:
NM_175638.3
NBCI Gene record:
Wnk4 (69847)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175638.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361782 ATGCTAGACTGGCACCTATAT pLKO_005 3041 CDS 100% 13.200 10.560 N Wnk4 n/a
2 TRCN0000028827 GATGCTAGACTGGCACCTATA pLKO.1 3040 CDS 100% 10.800 8.640 N Wnk4 n/a
3 TRCN0000028820 CCTCCCATTCTCTCCTAGTTA pLKO.1 2718 CDS 100% 5.625 4.500 N Wnk4 n/a
4 TRCN0000007021 CCGATACCTCAAGTTTGACAT pLKO.1 609 CDS 100% 4.950 3.960 N WNK4 n/a
5 TRCN0000028835 CGATACCTCAAGTTTGACATT pLKO.1 610 CDS 100% 4.950 3.960 N Wnk4 n/a
6 TRCN0000361841 CTCCCATTCTCTCCTAGTTAT pLKO_005 2719 CDS 100% 13.200 9.240 N Wnk4 n/a
7 TRCN0000361780 AGAATGAGGCTTCCCGTAATC pLKO_005 2999 CDS 100% 10.800 7.560 N Wnk4 n/a
8 TRCN0000028795 CCAGCTACTCATCAACTACAT pLKO.1 1817 CDS 100% 4.950 3.465 N Wnk4 n/a
9 TRCN0000028769 CCAGCATCAATCCTTCCTCTT pLKO.1 1788 CDS 100% 4.050 2.835 N Wnk4 n/a
10 TRCN0000199167 CCTGGCATCATGCGAAGGAAC pLKO.1 3670 CDS 100% 1.350 0.945 N WNK4 n/a
11 TRCN0000367529 ATTGCAGCTGCCATGGTATAT pLKO_005 2236 CDS 100% 13.200 9.240 N WNK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175638.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489323 AGGCTACCCCTGATCACTCTATTA pLX_317 9.8% 81.8% 82.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV