Transcript: Mouse NM_175646.4

Mus musculus thioredoxin-like 4B (Txnl4b), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Txnl4b (234723)
Length:
1890
CDS:
249..698

Additional Resources:

NCBI RefSeq record:
NM_175646.4
NBCI Gene record:
Txnl4b (234723)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175646.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247306 GTCTCCGGATCACACTAAATT pLKO_005 533 CDS 100% 15.000 12.000 N Txnl4b n/a
2 TRCN0000247307 AGCACATGAAGGTGGATTATG pLKO_005 511 CDS 100% 13.200 9.240 N Txnl4b n/a
3 TRCN0000247304 GCTTATCTTGAACTAACTAAT pLKO_005 1079 3UTR 100% 13.200 9.240 N Txnl4b n/a
4 TRCN0000257655 TACATTCCCTCTACCGTATTT pLKO_005 477 CDS 100% 13.200 9.240 N Txnl4b n/a
5 TRCN0000064614 CCAAACAAGACTTCATAGATT pLKO.1 571 CDS 100% 5.625 3.938 N TXNL4B n/a
6 TRCN0000175028 GCTGGATGATATTCTCTCAAA pLKO.1 368 CDS 100% 4.950 3.465 N Txnl4b n/a
7 TRCN0000193369 CCGTTTATCTTGACTTTGCTT pLKO.1 939 3UTR 100% 3.000 2.100 N Txnl4b n/a
8 TRCN0000247305 CCCAAGAACGTGCCCAAATAT pLKO_005 654 CDS 100% 15.000 9.000 N Txnl4b n/a
9 TRCN0000215967 CAAACAAGACTTCATAGATTT pLKO.1 572 CDS 100% 13.200 7.920 N Txnl4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175646.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03497 pDONR223 100% 87.9% 97.3% None (many diffs) n/a
2 ccsbBroad304_03497 pLX_304 0% 87.9% 97.3% V5 (many diffs) n/a
3 TRCN0000474876 CCTTCCTAGACCTAGACTTGACTT pLX_317 100% 87.9% 97.3% V5 (many diffs) n/a
Download CSV