Transcript: Human NM_175834.3

Homo sapiens keratin 79 (KRT79), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KRT79 (338785)
Length:
2123
CDS:
52..1659

Additional Resources:

NCBI RefSeq record:
NM_175834.3
NBCI Gene record:
KRT79 (338785)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426322 CCCACGTGTCTAACACCAATG pLKO_005 926 CDS 100% 6.000 8.400 N KRT79 n/a
2 TRCN0000116505 GCGGAAGACCACTACGGTCAA pLKO.1 1617 CDS 100% 1.350 1.080 N KRT79 n/a
3 TRCN0000436874 GGGACACCAAGAACGAGATTG pLKO_005 1118 CDS 100% 10.800 7.560 N KRT79 n/a
4 TRCN0000116504 CAAGGGTGGATTCAGCACAAA pLKO.1 1542 CDS 100% 4.950 3.465 N KRT79 n/a
5 TRCN0000116502 CGCTCAAATCTACTCAGGTTT pLKO.1 1811 3UTR 100% 4.950 3.465 N KRT79 n/a
6 TRCN0000116503 CGGATGGATCTGCATGGCAAA pLKO.1 835 CDS 100% 4.050 2.835 N KRT79 n/a
7 TRCN0000116506 GCCACAAGAGTATCTCTGTCA pLKO.1 251 CDS 100% 2.640 1.848 N KRT79 n/a
8 TRCN0000084029 CCAGGAGCTGATGAATGTCAA pLKO.1 1338 CDS 100% 4.950 2.475 Y KRT6A n/a
9 TRCN0000062387 GCAGATCAAGACCCTCAACAA pLKO.1 483 CDS 100% 4.950 2.475 Y KRT8 n/a
10 TRCN0000116955 GAGGACTTCAAGAACAAGTAT pLKO.1 733 CDS 100% 5.625 2.813 Y KRT8P11 n/a
11 TRCN0000116954 CCTCCTTCATCGACAAGGTAT pLKO.1 512 CDS 100% 4.950 2.475 Y KRT8P11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10004 pDONR223 100% 99.8% 99.8% None 242T>C;1116G>T n/a
2 ccsbBroad304_10004 pLX_304 0% 99.8% 99.8% V5 242T>C;1116G>T n/a
3 TRCN0000470688 AGGCCTCTAGCCCCACTGTTAACC pLX_317 16.4% 99.8% 99.8% V5 242T>C;1116G>T n/a
Download CSV