Transcript: Human NM_175920.4

Homo sapiens leucyl and cystinyl aminopeptidase (LNPEP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
LNPEP (4012)
Length:
12383
CDS:
368..3403

Additional Resources:

NCBI RefSeq record:
NM_175920.4
NBCI Gene record:
LNPEP (4012)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175920.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296804 GACTGGTGACTAGGGTATTTA pLKO_005 2694 CDS 100% 15.000 21.000 N LNPEP n/a
2 TRCN0000296807 TTCATAGCACAGGTCATAATA pLKO_005 951 CDS 100% 15.000 21.000 N LNPEP n/a
3 TRCN0000073845 CCGCTTTATCAAATATGCCTA pLKO.1 1302 CDS 100% 2.640 3.696 N LNPEP n/a
4 TRCN0000296802 TTCTTAGATGCTCGATTTAAA pLKO_005 1856 CDS 100% 15.000 10.500 N LNPEP n/a
5 TRCN0000073844 CCATGAAGAAAGATTCCTTAA pLKO.1 1878 CDS 100% 10.800 7.560 N LNPEP n/a
6 TRCN0000031110 CCCACTTAAGAAATTGGATTT pLKO.1 1561 CDS 100% 10.800 7.560 N Lnpep n/a
7 TRCN0000296805 GCATTGGAATGTGGTACAAAG pLKO_005 3831 3UTR 100% 10.800 7.560 N LNPEP n/a
8 TRCN0000031111 CCTTATGTTCTGAGTGACAAA pLKO.1 2483 CDS 100% 4.950 3.465 N Lnpep n/a
9 TRCN0000073843 GCACAATTATACGTTGAAGAT pLKO.1 1087 CDS 100% 4.950 3.465 N LNPEP n/a
10 TRCN0000073846 CCTGTTTCAGACAGACCTCAT pLKO.1 2629 CDS 100% 4.050 2.835 N LNPEP n/a
11 TRCN0000073847 GAGCCTTGTTTACATCCTCTA pLKO.1 422 CDS 100% 4.050 2.835 N LNPEP n/a
12 TRCN0000307279 GAGCCTTGTTTACATCCTCTA pLKO_005 422 CDS 100% 4.050 2.835 N LNPEP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175920.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06534 pDONR223 100% 99.9% 84.9% None 1267A>G;2582C>A n/a
2 ccsbBroad304_06534 pLX_304 0% 99.9% 84.9% V5 (not translated due to prior stop codon) 1267A>G;2582C>A n/a
3 TRCN0000468534 TTACGATGGTTATGACATTATATG pLX_317 7.5% 99.9% 84.9% V5 (not translated due to prior stop codon) 1267A>G;2582C>A n/a
Download CSV