Transcript: Human NM_175924.4

Homo sapiens immunoglobulin like domain containing receptor 1 (ILDR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ILDR1 (286676)
Length:
2723
CDS:
171..1679

Additional Resources:

NCBI RefSeq record:
NM_175924.4
NBCI Gene record:
ILDR1 (286676)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_175924.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060986 CCGAGCAGATCTCGTGATAAA pLKO.1 548 CDS 100% 13.200 18.480 N ILDR1 n/a
2 TRCN0000372676 AGTTAGAGTTCGAGGAATTAC pLKO_005 2154 3UTR 100% 13.200 10.560 N ILDR1 n/a
3 TRCN0000372675 GACTACTACTCAGCGTCATAC pLKO_005 384 CDS 100% 10.800 8.640 N ILDR1 n/a
4 TRCN0000060985 CCAATGGTGTCCTGGAGTATT pLKO.1 883 CDS 100% 13.200 9.240 N ILDR1 n/a
5 TRCN0000372677 AGAGTTTGAGATTGGGTATAG pLKO_005 1832 3UTR 100% 10.800 7.560 N ILDR1 n/a
6 TRCN0000060987 CCAGGCAAGAATAGCAGGAAA pLKO.1 1593 CDS 100% 4.950 3.465 N ILDR1 n/a
7 TRCN0000060984 CCTCAGTATTGCTGCTGCTAT pLKO.1 750 CDS 100% 4.950 3.465 N ILDR1 n/a
8 TRCN0000060983 GAACGCTATGTCACCCTGTTT pLKO.1 264 CDS 100% 4.950 3.465 N ILDR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175924.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09990 pDONR223 100% 99.9% 100% None 1413T>G n/a
2 TRCN0000476799 AATTTTCCTAGGTTTGTCAAAAAC pLX_317 15% 99.9% 100% V5 1413T>G n/a
Download CSV