Transcript: Mouse NM_176837.2

Mus musculus Rho GTPase activating protein 18 (Arhgap18), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Arhgap18 (73910)
Length:
3616
CDS:
73..2064

Additional Resources:

NCBI RefSeq record:
NM_176837.2
NBCI Gene record:
Arhgap18 (73910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249049 ATTCAGCTGCACCCAATTATT pLKO_005 2138 3UTR 100% 15.000 21.000 N Arhgap18 n/a
2 TRCN0000200492 CCAAAGAGTCATAGATAACAA pLKO.1 1455 CDS 100% 5.625 4.500 N Arhgap18 n/a
3 TRCN0000201719 GCTTTGAACCTCCTTGTCATT pLKO.1 1384 CDS 100% 4.950 3.960 N Arhgap18 n/a
4 TRCN0000216283 CAAGAACTAGAAGCGAAATTT pLKO.1 1204 CDS 100% 15.000 10.500 N Arhgap18 n/a
5 TRCN0000249053 CAAGAACTAGAAGCGAAATTT pLKO_005 1204 CDS 100% 15.000 10.500 N Arhgap18 n/a
6 TRCN0000249051 CGTGACGTCAGAGACATATTT pLKO_005 571 CDS 100% 15.000 10.500 N Arhgap18 n/a
7 TRCN0000249050 CGAATGCCGAGTGGGTCATAA pLKO_005 2027 CDS 100% 13.200 9.240 N Arhgap18 n/a
8 TRCN0000249052 TGGTATTCCTTTAACGATATT pLKO_005 1038 CDS 100% 13.200 9.240 N Arhgap18 n/a
9 TRCN0000201720 GACAGCAAATGTCATGCACTT pLKO.1 1593 CDS 100% 4.050 2.835 N Arhgap18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176837.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09362 pDONR223 100% 84.1% 84.5% None (many diffs) n/a
2 ccsbBroad304_09362 pLX_304 0% 84.1% 84.5% V5 (many diffs) n/a
3 TRCN0000476824 GGTGGCCTATATCCGCTTCCATTG pLX_317 21.4% 84.1% 84.5% V5 (many diffs) n/a
Download CSV