Transcript: Mouse NM_176849.3

Mus musculus arginine and glutamate rich 1 (Arglu1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Arglu1 (234023)
Length:
1731
CDS:
221..1036

Additional Resources:

NCBI RefSeq record:
NM_176849.3
NBCI Gene record:
Arglu1 (234023)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248690 GACCACTGACTTCGGAGTTAT pLKO_005 1367 3UTR 100% 13.200 18.480 N Arglu1 n/a
2 TRCN0000248694 GAAGTTCTCCGAAGGGTTGAA pLKO_005 680 CDS 100% 4.950 6.930 N Arglu1 n/a
3 TRCN0000215554 GATTGAATGGCAAACTCTGAA pLKO.1 1031 CDS 100% 4.950 3.960 N Arglu1 n/a
4 TRCN0000248693 CTGAAGAACAGTTGAGAATTG pLKO_005 873 CDS 100% 10.800 7.560 N Arglu1 n/a
5 TRCN0000248692 AGTGGAAGAATTGGTAGCAAA pLKO_005 613 CDS 100% 4.950 3.465 N Arglu1 n/a
6 TRCN0000173150 CAAGAGCTCCAAGCACAACAA pLKO.1 265 CDS 100% 4.950 3.465 N Arglu1 n/a
7 TRCN0000144660 GAGGAAAGGATGAAACTAGAA pLKO.1 917 CDS 100% 4.950 3.465 N ARGLU1 n/a
8 TRCN0000144680 GAAAGATTCATGAGGAAAGGA pLKO.1 906 CDS 100% 3.000 2.100 N ARGLU1 n/a
9 TRCN0000248691 AGGAACTGGAGCGGATATTAG pLKO_005 810 CDS 100% 13.200 7.920 N Arglu1 n/a
10 TRCN0000140602 GAAGCCAAACGCATCATGGAA pLKO.1 701 CDS 100% 3.000 1.800 N ARGLU1 n/a
11 TRCN0000216403 GAGAATTGTTGAAGAACAAAG pLKO.1 886 CDS 100% 1.080 0.648 N Arglu1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12153 pDONR223 100% 74% 65.1% None (many diffs) n/a
2 ccsbBroad304_12153 pLX_304 0% 74% 65.1% V5 (many diffs) n/a
Download CSV