Transcript: Mouse NM_176921.3

Mus musculus RIKEN cDNA 6030419C18 gene (6030419C18Rik), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
6030419C18Rik (319477)
Length:
2139
CDS:
1206..2084

Additional Resources:

NCBI RefSeq record:
NM_176921.3
NBCI Gene record:
6030419C18Rik (319477)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_176921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202436 GTGAGTCAGATCGACAAGCTA pLKO.1 1365 CDS 100% 3.000 2.400 N 6030419C18Rik n/a
2 TRCN0000202184 CTTGAAGGCATCCTGAGAGAA pLKO.1 1311 CDS 100% 4.950 3.465 N 6030419C18Rik n/a
3 TRCN0000201810 GACAAGCTAACCTCTGACTTT pLKO.1 1377 CDS 100% 4.950 3.465 N 6030419C18Rik n/a
4 TRCN0000190823 GCTAACCTCTGACTTTGACTT pLKO.1 1382 CDS 100% 4.950 3.465 N 6030419C18Rik n/a
5 TRCN0000201848 GAGTTCTGTTCTTTCCTGGAT pLKO.1 1536 CDS 100% 2.640 1.848 N 6030419C18Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_176921.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05573 pDONR223 100% 86.5% 88.7% None (many diffs) n/a
2 ccsbBroad304_05573 pLX_304 0% 86.5% 88.7% V5 (many diffs) n/a
3 TRCN0000478013 TGTGGCGTTCTCAATCAAGCTGTG pLX_317 25.9% 86.5% 88.7% V5 (many diffs) n/a
Download CSV