Transcript: Mouse NM_177167.4

Mus musculus protein phosphatase 1E (PP2C domain containing) (Ppm1e), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ppm1e (320472)
Length:
6315
CDS:
92..2341

Additional Resources:

NCBI RefSeq record:
NM_177167.4
NBCI Gene record:
Ppm1e (320472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177167.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080629 GCTGCTATTTATGCCTCCGTT pLKO.1 920 CDS 100% 2.640 3.696 N Ppm1e n/a
2 TRCN0000080632 GCAGCGTGGATTCAGGTTTAA pLKO.1 2107 CDS 100% 13.200 9.240 N Ppm1e n/a
3 TRCN0000080630 GCGTCTAGGTTGTATCATTTA pLKO.1 2066 CDS 100% 13.200 9.240 N Ppm1e n/a
4 TRCN0000080628 GCCTACTCTAAAGGAAACAAT pLKO.1 2680 3UTR 100% 5.625 3.938 N Ppm1e n/a
5 TRCN0000080631 GCTCACTGTATCCCAAAGGAA pLKO.1 620 CDS 100% 3.000 2.100 N Ppm1e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177167.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11633 pDONR223 100% 87.8% 89.1% None (many diffs) n/a
2 TRCN0000475566 CTAACCTAATGTCGGTTCTATATT pLX_317 13.1% 87.8% 89.1% V5 (many diffs) n/a
Download CSV