Transcript: Mouse NM_177324.2

Mus musculus SET binding factor 2 (Sbf2), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Sbf2 (319934)
Length:
7163
CDS:
160..5778

Additional Resources:

NCBI RefSeq record:
NM_177324.2
NBCI Gene record:
Sbf2 (319934)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110162 CCGTTGTTTCAATAATGGAAA pLKO.1 1754 CDS 100% 4.950 6.930 N Sbf2 n/a
2 TRCN0000110161 CCCGTTGTTTCAATAATGGAA pLKO.1 1753 CDS 100% 3.000 4.200 N Sbf2 n/a
3 TRCN0000110163 CATCAACAGTTTGACTACATA pLKO.1 1972 CDS 100% 5.625 3.938 N Sbf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469814 AGCACATGAAACATATGTGAGCCG pLX_317 7.9% 87.6% 92.4% V5 (many diffs) n/a
Download CSV