Transcript: Mouse NM_177364.3

Mus musculus SH3 and PX domains 2B (Sh3pxd2b), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Sh3pxd2b (268396)
Length:
7432
CDS:
84..2810

Additional Resources:

NCBI RefSeq record:
NM_177364.3
NBCI Gene record:
Sh3pxd2b (268396)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177364.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415352 AGCAGAGGATCATTCCATTTC pLKO_005 289 CDS 100% 10.800 15.120 N Sh3pxd2b n/a
2 TRCN0000179438 GCCCAACAAGCATTATGTCTA pLKO.1 143 CDS 100% 4.950 6.930 N SH3PXD2B n/a
3 TRCN0000438450 GACCACCCTCAATGCTCAATT pLKO_005 3129 3UTR 100% 13.200 10.560 N Sh3pxd2b n/a
4 TRCN0000417074 GTCTCAAGAGAAAGCCTTATT pLKO_005 2096 CDS 100% 13.200 9.240 N Sh3pxd2b n/a
5 TRCN0000439975 GAGTGAAGACCACGTGGATAT pLKO_005 2042 CDS 100% 10.800 7.560 N Sh3pxd2b n/a
6 TRCN0000430236 GCTCGTGACCAGGATGAAATG pLKO_005 783 CDS 100% 10.800 7.560 N Sh3pxd2b n/a
7 TRCN0000105934 GAGCATATTGGGAAGAAGAAA pLKO.1 486 CDS 100% 5.625 3.938 N Sh3pxd2b n/a
8 TRCN0000105933 CGTTAAGCAGAGATCACCAAA pLKO.1 1085 CDS 100% 4.950 3.465 N Sh3pxd2b n/a
9 TRCN0000105931 GCCAACTTTGAAGGAGATGAA pLKO.1 2649 CDS 100% 4.950 3.465 N Sh3pxd2b n/a
10 TRCN0000105930 CCAGGCTTATTACAGCAATAA pLKO.1 6850 3UTR 100% 1.320 0.924 N Sh3pxd2b n/a
11 TRCN0000105932 CCCTGGCATGATATTGCCAAT pLKO.1 1745 CDS 100% 0.405 0.284 N Sh3pxd2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177364.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.