Transcript: Mouse NM_177412.1

Mus musculus transmembrane and coiled coil domains 1 (Tmcc1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Mus musculus (mouse)
Gene:
Tmcc1 (330401)
Length:
5719
CDS:
301..2250

Additional Resources:

NCBI RefSeq record:
NM_177412.1
NBCI Gene record:
Tmcc1 (330401)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177412.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367286 CCTTACAGGAAGAGCGGTATA pLKO_005 1778 CDS 100% 10.800 15.120 N Tmcc1 n/a
2 TRCN0000127504 CAGGACGTTCAGCACTTTATT pLKO.1 2145 CDS 100% 15.000 10.500 N TMCC1 n/a
3 TRCN0000367287 AGCTTGGAGAACTGCACTAAA pLKO_005 2553 3UTR 100% 13.200 9.240 N Tmcc1 n/a
4 TRCN0000367212 CCTAACCTGAAAGACTCATTA pLKO_005 1447 CDS 100% 13.200 9.240 N Tmcc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177412.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07830 pDONR223 100% 90.4% 95.4% None (many diffs) n/a
2 ccsbBroad304_07830 pLX_304 0% 90.4% 95.4% V5 (many diffs) n/a
3 TRCN0000470452 CGTGGCACTCAGACCCTCCTAATC pLX_317 21.1% 90.4% 95.4% V5 (many diffs) n/a
Download CSV