Transcript: Human NM_177424.3

Homo sapiens syntaxin 12 (STX12), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
STX12 (23673)
Length:
3034
CDS:
90..920

Additional Resources:

NCBI RefSeq record:
NM_177424.3
NBCI Gene record:
STX12 (23673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177424.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382482 GACACTACAGTCTCGTAATAT pLKO_005 1231 3UTR 100% 15.000 21.000 N STX12 n/a
2 TRCN0000065050 GCAGGATTTGGAACTTATTAA pLKO.1 614 CDS 100% 15.000 12.000 N STX12 n/a
3 TRCN0000065048 CGAGCTGCTTACTATCAGAAA pLKO.1 804 CDS 100% 4.950 3.960 N STX12 n/a
4 TRCN0000333598 CGAGCTGCTTACTATCAGAAA pLKO_005 804 CDS 100% 4.950 3.960 N STX12 n/a
5 TRCN0000065052 GCTTGTCCTGTCAGTGATTAT pLKO.1 854 CDS 100% 13.200 9.240 N STX12 n/a
6 TRCN0000333599 GCTTGTCCTGTCAGTGATTAT pLKO_005 854 CDS 100% 13.200 9.240 N STX12 n/a
7 TRCN0000065051 GCCACTGCTCAGATAAAGAAT pLKO.1 204 CDS 100% 5.625 3.938 N STX12 n/a
8 TRCN0000333671 GCCACTGCTCAGATAAAGAAT pLKO_005 204 CDS 100% 5.625 3.938 N STX12 n/a
9 TRCN0000065049 CGCCAAGGAAACAAATGAATT pLKO.1 308 CDS 100% 0.000 0.000 N STX12 n/a
10 TRCN0000333672 CGCCAAGGAAACAAATGAATT pLKO_005 308 CDS 100% 0.000 0.000 N STX12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177424.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02828 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02828 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465923 CGAAAATCCCAACAAGGCAGTAGT pLX_317 44.2% 100% 100% V5 n/a
Download CSV