Transcript: Human NM_177454.4

Homo sapiens family with sequence similarity 171 member B (FAM171B), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
FAM171B (165215)
Length:
5731
CDS:
115..2595

Additional Resources:

NCBI RefSeq record:
NM_177454.4
NBCI Gene record:
FAM171B (165215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177454.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125293 CACTCCTTTATAGACCTGAAA pLKO.1 2173 CDS 100% 4.950 6.930 N Fam171b n/a
2 TRCN0000020094 CGGAACAATTACATACTGCTA pLKO.1 1766 CDS 100% 2.640 3.696 N FAM171B n/a
3 TRCN0000020096 CGCCCACTGATTCCCATAAAT pLKO.1 2572 CDS 100% 15.000 12.000 N FAM171B n/a
4 TRCN0000434375 CTGACTTCAGGCATCATATTA pLKO_005 2990 3UTR 100% 15.000 10.500 N FAM171B n/a
5 TRCN0000430920 ACACAGGTGCTTGGGTAAATC pLKO_005 1004 CDS 100% 13.200 9.240 N FAM171B n/a
6 TRCN0000413063 TAAATTGCAGTACGAACTTAA pLKO_005 2652 3UTR 100% 13.200 9.240 N FAM171B n/a
7 TRCN0000429989 CAACGTTACTGGCTATCTTAC pLKO_005 750 CDS 100% 10.800 7.560 N FAM171B n/a
8 TRCN0000424069 GATGAATTTACAGTATCTAAG pLKO_005 2797 3UTR 100% 10.800 7.560 N FAM171B n/a
9 TRCN0000020095 CCTACAAATTAGGACTTAGTT pLKO.1 497 CDS 100% 5.625 3.938 N FAM171B n/a
10 TRCN0000020097 CGAAGACAAATTCCACAGTAA pLKO.1 443 CDS 100% 4.950 3.465 N FAM171B n/a
11 TRCN0000020098 GCACTCCTTTATAGACCTGAA pLKO.1 2172 CDS 100% 4.050 2.835 N FAM171B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177454.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13341 pDONR223 100% 99.6% 99.6% None (many diffs) n/a
2 ccsbBroad304_13341 pLX_304 0% 99.6% 99.6% V5 (many diffs) n/a
3 TRCN0000466410 AGAACAACCTTTAAGGACCCCTCA pLX_317 16.5% 99.6% 99.6% V5 (many diffs) n/a
Download CSV