Transcript: Human NM_177455.3

Homo sapiens basic helix-loop-helix family member a15 (BHLHA15), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
BHLHA15 (168620)
Length:
706
CDS:
57..626

Additional Resources:

NCBI RefSeq record:
NM_177455.3
NBCI Gene record:
BHLHA15 (168620)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005336 GCGGATGCACAAGCTAAATAA pLKO.1 314 CDS 100% 15.000 21.000 N BHLHA15 n/a
2 TRCN0000005337 GCACAAGCTAAATAACGCCTT pLKO.1 320 CDS 100% 2.160 3.024 N BHLHA15 n/a
3 TRCN0000005338 CAAATCGCTGACGGCCACCAT pLKO.1 428 CDS 100% 0.880 0.704 N BHLHA15 n/a
4 TRCN0000005340 CAAGAACTACATCAAATCGCT pLKO.1 416 CDS 100% 0.750 0.525 N BHLHA15 n/a
5 TRCN0000005339 CCGTCGTGACAGCAGCATCCA pLKO.1 260 CDS 100% 0.000 0.000 N BHLHA15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05145 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05145 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477824 TGCTAACATTACCCTGGCCTGTCC pLX_317 63.2% 100% 100% V5 n/a
Download CSV