Transcript: Human NM_177456.2

Homo sapiens MAGE family member C3 (MAGEC3), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
MAGEC3 (139081)
Length:
1707
CDS:
528..1568

Additional Resources:

NCBI RefSeq record:
NM_177456.2
NBCI Gene record:
MAGEC3 (139081)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083125 CATGAGTTCATAGAGCTAATT pLKO.1 1137 CDS 100% 13.200 9.240 N MAGEC3 n/a
2 TRCN0000413674 TCTCAGTATGATCTTCATAAA pLKO_005 1289 CDS 100% 13.200 9.240 N MAGEC3 n/a
3 TRCN0000083126 CCATGAGTTCATAGAGCTAAT pLKO.1 1136 CDS 100% 10.800 7.560 N MAGEC3 n/a
4 TRCN0000442830 CCTATGAGGGAAGCCTGATTG pLKO_005 1228 CDS 100% 10.800 7.560 N MAGEC3 n/a
5 TRCN0000083127 CGACAACCACTCCTATTTCTT pLKO.1 1187 CDS 100% 5.625 3.938 N MAGEC3 n/a
6 TRCN0000083124 GCAAGAGAAGTCTTAGAGTTT pLKO.1 1519 CDS 100% 4.950 3.465 N MAGEC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04924 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04924 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474881 AGGTGCAAGCATGGCAACCTTTTT pLX_317 27.5% 100% 100% V5 n/a
Download CSV