Transcript: Mouse NM_177462.5

Mus musculus zinc finger, MYM-type 6 (Zmym6), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Zmym6 (100177)
Length:
4229
CDS:
268..4017

Additional Resources:

NCBI RefSeq record:
NM_177462.5
NBCI Gene record:
Zmym6 (100177)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177462.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375715 ATGTCCGCTTCATCGACTATG pLKO_005 2819 CDS 100% 10.800 15.120 N Zmym6 n/a
2 TRCN0000103908 CCTCTTTCTAATAGCACAATT pLKO.1 2668 CDS 100% 13.200 10.560 N Zmym6 n/a
3 TRCN0000103909 CGACTACTGTAAGCTACAGAA pLKO.1 1440 CDS 100% 4.950 3.960 N Zmym6 n/a
4 TRCN0000323948 CGACTACTGTAAGCTACAGAA pLKO_005 1440 CDS 100% 4.950 3.960 N Zmym6 n/a
5 TRCN0000375716 TAGCCTATCTAGCAGATATAT pLKO_005 3377 CDS 100% 15.000 10.500 N Zmym6 n/a
6 TRCN0000295266 TAGCTACAACACCAGTTATAA pLKO_005 1916 CDS 100% 15.000 10.500 N Zmym6 n/a
7 TRCN0000103907 CCAAGAATACAGTGACATTTA pLKO.1 3041 CDS 100% 13.200 9.240 N Zmym6 n/a
8 TRCN0000295341 TCAGATTTGGCCAGGTATTTC pLKO_005 3331 CDS 100% 13.200 9.240 N Zmym6 n/a
9 TRCN0000103905 CCAGATTGCTTTGACCCATTT pLKO.1 1275 CDS 100% 10.800 7.560 N Zmym6 n/a
10 TRCN0000287976 CCAGATTGCTTTGACCCATTT pLKO_005 1275 CDS 100% 10.800 7.560 N Zmym6 n/a
11 TRCN0000103906 GCATCCAAACAGAGAGACCTT pLKO.1 3916 CDS 100% 2.640 1.848 N Zmym6 n/a
12 TRCN0000287902 GCATCCAAACAGAGAGACCTT pLKO_005 3916 CDS 100% 2.640 1.848 N Zmym6 n/a
13 TRCN0000295277 AGCCTGTTGTTACCATATATA pLKO_005 755 CDS 100% 15.000 9.000 N Zmym6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177462.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.