Transcript: Mouse NM_177464.4

Mus musculus R3H domain and coiled-coil containing 1 like (R3hcc1l), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
R3hcc1l (52013)
Length:
3979
CDS:
68..2395

Additional Resources:

NCBI RefSeq record:
NM_177464.4
NBCI Gene record:
R3hcc1l (52013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177464.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250869 CACGTCTTCTACTAGAGTTAT pLKO_005 1827 CDS 100% 13.200 18.480 N R3hcc1l n/a
2 TRCN0000250866 CCGTGACAATGATGGATTATT pLKO_005 3673 3UTR 100% 15.000 10.500 N R3hcc1l n/a
3 TRCN0000250868 AGCGGTCCTCGTGCATGAAAT pLKO_005 1126 CDS 100% 13.200 9.240 N R3hcc1l n/a
4 TRCN0000178903 CCTAAGTGCTTGCTCAGATAT pLKO.1 1384 CDS 100% 13.200 9.240 N R3hcc1l n/a
5 TRCN0000215761 GGAAACATCTGTAGATCTAAA pLKO.1 1717 CDS 100% 13.200 9.240 N R3hcc1l n/a
6 TRCN0000250867 TGCTTCCTCTTTACCCATAAA pLKO_005 1474 CDS 100% 13.200 9.240 N R3hcc1l n/a
7 TRCN0000258119 AGAGGCCTTGCACGACCTAAA pLKO_005 1615 CDS 100% 10.800 7.560 N R3hcc1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177464.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11861 pDONR223 100% 21.3% 21.9% None (many diffs) n/a
2 ccsbBroad304_11861 pLX_304 0% 21.3% 21.9% V5 (many diffs) n/a
3 TRCN0000465466 TGGTAGACTAATACCTAGCTCCGG pLX_317 62.2% 21.3% 21.9% V5 (many diffs) n/a
Download CSV