Transcript: Human NM_177553.3

Homo sapiens growth arrest specific 2 (GAS2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
GAS2 (2620)
Length:
2229
CDS:
249..1190

Additional Resources:

NCBI RefSeq record:
NM_177553.3
NBCI Gene record:
GAS2 (2620)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_177553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117857 CGTTGATACTTTGACGAGTAA pLKO.1 1915 3UTR 100% 4.950 6.930 N GAS2 n/a
2 TRCN0000088326 CCTTGTGGTTAACCAATCTAT pLKO.1 370 CDS 100% 5.625 4.500 N Gas2 n/a
3 TRCN0000335613 CCTTGTGGTTAACCAATCTAT pLKO_005 370 CDS 100% 5.625 4.500 N Gas2 n/a
4 TRCN0000117860 TCTATTTGAATCGGAAGGTTT pLKO.1 635 CDS 100% 4.950 3.960 N GAS2 n/a
5 TRCN0000430992 ATGATGATTAGTGTGATAATG pLKO_005 1626 3UTR 100% 13.200 9.240 N GAS2 n/a
6 TRCN0000420792 ATGATGCAGTGAAACGAATTT pLKO_005 856 CDS 100% 13.200 9.240 N GAS2 n/a
7 TRCN0000117861 CCAGAGACAATACAGCAAATT pLKO.1 574 CDS 100% 13.200 9.240 N GAS2 n/a
8 TRCN0000117859 CCTGGTTTGATAAAGCTGGAA pLKO.1 738 CDS 100% 2.640 1.848 N GAS2 n/a
9 TRCN0000117858 GCCCACAAAGAATCTACCGTT pLKO.1 506 CDS 100% 2.640 1.848 N GAS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10838 pDONR223 100% 44.7% 43.7% None (many diffs) n/a
2 ccsbBroad304_10838 pLX_304 0% 44.7% 43.7% V5 (many diffs) n/a
3 TRCN0000470161 AAGAAGACCAACCGCAGCCACAGC pLX_317 95.4% 44.7% 43.7% V5 (many diffs) n/a
Download CSV