Transcript: Mouse NM_177572.4

Mus musculus ribosomal modification protein rimK-like family member A (Rimkla), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rimkla (194237)
Length:
4093
CDS:
140..1282

Additional Resources:

NCBI RefSeq record:
NM_177572.4
NBCI Gene record:
Rimkla (194237)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177572.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250562 CGTGGTGGTTGTTCGAGTATC pLKO_005 343 CDS 100% 10.800 15.120 N Rimkla n/a
2 TRCN0000250561 TCGACCAGGCATGCAACTTAG pLKO_005 987 CDS 100% 10.800 15.120 N Rimkla n/a
3 TRCN0000215794 CAATGCTCTTTGGCTATTAAT pLKO.1 2603 3UTR 100% 15.000 10.500 N Rimkla n/a
4 TRCN0000250565 CAATGCTCTTTGGCTATTAAT pLKO_005 2603 3UTR 100% 15.000 10.500 N Rimkla n/a
5 TRCN0000250564 ACCGTCCTCAAAGCATCTTAA pLKO_005 438 CDS 100% 13.200 9.240 N Rimkla n/a
6 TRCN0000250563 CAAGCCTGGTTACAGCATTAA pLKO_005 1262 CDS 100% 13.200 9.240 N Rimkla n/a
7 TRCN0000191013 CATCTTAAACTGCATCAACAA pLKO.1 451 CDS 100% 4.950 2.970 N Rimkla n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177572.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13535 pDONR223 100% 75.4% 78.2% None (many diffs) n/a
2 ccsbBroad304_13535 pLX_304 0% 75.4% 78.2% V5 (many diffs) n/a
3 TRCN0000465970 AAATCCTAGTAACGCCCCAATATA pLX_317 37.8% 75.4% 78.2% V5 (many diffs) n/a
Download CSV