Transcript: Mouse NM_177574.4

Mus musculus vacuolar protein sorting 37D (Vps37d), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Vps37d (194309)
Length:
1306
CDS:
68..598

Additional Resources:

NCBI RefSeq record:
NM_177574.4
NBCI Gene record:
Vps37d (194309)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177574.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249310 GGGTCCAGACAAACTTGATTC pLKO_005 624 3UTR 100% 10.800 8.640 N Vps37d n/a
2 TRCN0000249312 CTTACTGGATTGTTCTCATAT pLKO_005 988 3UTR 100% 13.200 9.240 N Vps37d n/a
3 TRCN0000249309 CCAAGCCAGGTCCTCAAATGA pLKO_005 872 3UTR 100% 5.625 3.938 N Vps37d n/a
4 TRCN0000257871 ACACTACTGGGCTCGAACAAC pLKO_005 959 3UTR 100% 4.950 3.465 N Vps37d n/a
5 TRCN0000249311 CTCCGGGATCTGCTTCAAGAT pLKO_005 146 CDS 100% 4.950 3.465 N Vps37d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177574.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13299 pDONR223 100% 70% 68.7% None (many diffs) n/a
2 ccsbBroad304_13299 pLX_304 0% 70% 68.7% V5 (many diffs) n/a
Download CSV