Transcript: Mouse NM_177628.4

Mus musculus family with sequence similarity 167, member A (Fam167a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fam167a (219148)
Length:
4252
CDS:
726..1373

Additional Resources:

NCBI RefSeq record:
NM_177628.4
NBCI Gene record:
Fam167a (219148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177628.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215372 CATAACAGTCACCAGTTATTA pLKO.1 3481 3UTR 100% 1.500 2.100 N Fam167a n/a
2 TRCN0000177911 CCAGAGTATCGATGAAGCTAT pLKO.1 1067 CDS 100% 4.950 3.960 N Fam167a n/a
3 TRCN0000200047 CCGAGGAGACATCAACAAGTT pLKO.1 1160 CDS 100% 4.950 3.465 N Fam167a n/a
4 TRCN0000182739 GAAGACCTTCCTACCTGGAAT pLKO.1 853 CDS 100% 4.950 3.465 N Fam167a n/a
5 TRCN0000197692 GAGACATCAACAAGTTGAAGA pLKO.1 1165 CDS 100% 4.950 3.465 N Fam167a n/a
6 TRCN0000200396 GAAGGCTTCCAGAGTATCGAT pLKO.1 1059 CDS 100% 3.000 2.100 N Fam167a n/a
7 TRCN0000177729 CAACAAGTTGAAGATCGAGCA pLKO.1 1172 CDS 100% 2.160 1.512 N Fam167a n/a
8 TRCN0000182244 CAACTCCAGAAGGTTCTCTCT pLKO.1 1346 CDS 100% 2.640 1.584 N Fam167a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177628.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09103 pDONR223 100% 82.4% 83.2% None (many diffs) n/a
2 ccsbBroad304_09103 pLX_304 0% 82.4% 83.2% V5 (many diffs) n/a
3 TRCN0000467090 TTTGCATTTCGGACCAAGTGCCTA pLX_317 56.3% 82.4% 83.2% V5 (many diffs) n/a
Download CSV