Transcript: Mouse NM_177683.2

Mus musculus vestigial like family member 4 (Vgll4), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Vgll4 (232334)
Length:
1327
CDS:
355..1218

Additional Resources:

NCBI RefSeq record:
NM_177683.2
NBCI Gene record:
Vgll4 (232334)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265297 GCCTCTTGCCCTGACTAAGAA pLKO_005 762 CDS 100% 5.625 4.500 N Vgll4 n/a
2 TRCN0000215443 GACAAGATGAACAACAATATC pLKO.1 397 CDS 100% 13.200 9.240 N Vgll4 n/a
3 TRCN0000250411 GACAAGATGAACAACAATATC pLKO_005 397 CDS 100% 13.200 9.240 N Vgll4 n/a
4 TRCN0000250410 ACACATGGCTTCAGATCAAAG pLKO_005 1085 CDS 100% 10.800 7.560 N Vgll4 n/a
5 TRCN0000175905 GTTCTGTGCTATGAAGGTGAA pLKO.1 421 CDS 100% 4.050 2.835 N Vgll4 n/a
6 TRCN0000173136 CCTCTGTGATTACCTGTGCAT pLKO.1 830 CDS 100% 2.640 1.848 N Vgll4 n/a
7 TRCN0000250409 CCTAACTCGGTGTCCATCACT pLKO_005 1027 CDS 100% 3.000 1.800 N Vgll4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07466 pDONR223 100% 79% 78.4% None (many diffs) n/a
2 ccsbBroad304_07466 pLX_304 0% 79% 78.4% V5 (many diffs) n/a
3 TRCN0000467980 TATGCCTATGACTCGCAAGTTGCG pLX_317 34.3% 79% 78.4% V5 (many diffs) n/a
Download CSV