Construct: ORF TRCN0000467980
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009675.1_s317c1
- Derived from:
- ccsbBroadEn_07466
- DNA Barcode:
- TATGCCTATGACTCGCAAGTTGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VGLL4 (9686)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467980
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9686 | VGLL4 | vestigial like family member 4 | NM_014667.4 | 99.8% | 99.6% | 96A>G |
| 2 | human | 9686 | VGLL4 | vestigial like family member 4 | XM_024453835.1 | 99.8% | 99.6% | 96A>G |
| 3 | human | 9686 | VGLL4 | vestigial like family member 4 | XM_024453836.1 | 99.8% | 99.6% | 96A>G |
| 4 | human | 9686 | VGLL4 | vestigial like family member 4 | NM_001284390.2 | 93.6% | 91.8% | (many diffs) |
| 5 | human | 9686 | VGLL4 | vestigial like family member 4 | XM_017007541.1 | 93.6% | 91.8% | (many diffs) |
| 6 | human | 9686 | VGLL4 | vestigial like family member 4 | XM_011534267.2 | 93.6% | 91.8% | (many diffs) |
| 7 | human | 9686 | VGLL4 | vestigial like family member 4 | NM_001128219.3 | 92.9% | 87.9% | (many diffs) |
| 8 | human | 9686 | VGLL4 | vestigial like family member 4 | NM_001284391.1 | 79.6% | 79.6% | 0_1ins177 |
| 9 | human | 9686 | VGLL4 | vestigial like family member 4 | XM_011534269.1 | 79.6% | 79.6% | 0_1ins177 |
| 10 | human | 9686 | VGLL4 | vestigial like family member 4 | NM_001128220.3 | 71.9% | 71% | (many diffs) |
| 11 | human | 9686 | VGLL4 | vestigial like family member 4 | NM_001128221.3 | 70.9% | 70.6% | 1_1delAins253 |
| 12 | human | 9686 | VGLL4 | vestigial like family member 4 | XM_017007542.1 | 70.1% | 69.6% | (many diffs) |
| 13 | human | 9686 | VGLL4 | vestigial like family member 4 | XM_024453837.1 | 70.1% | 69.6% | (many diffs) |
| 14 | mouse | 232334 | Vgll4 | vestigial like family member 4 | XM_006506010.1 | 84.4% | 89.3% | (many diffs) |
| 15 | mouse | 232334 | Vgll4 | vestigial like family member 4 | XM_006506011.1 | 84.4% | 89.3% | (many diffs) |
| 16 | mouse | 232334 | Vgll4 | vestigial like family member 4 | NM_177683.2 | 79% | 78.4% | (many diffs) |
| 17 | mouse | 232334 | Vgll4 | vestigial like family member 4 | XM_006506012.1 | 75% | 78.9% | (many diffs) |
| 18 | mouse | 232334 | Vgll4 | vestigial like family member 4 | XM_006506014.2 | 59.6% | 61.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 936
- ORF length:
- 870
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gacgccattg gatgttttgt ccagggcagc atctctggtg catgctgatg 121 acgaaaaacg cgaagctgct ctcaggggag aacccagaat gcagaccctg ccggtggcct 181 ctgccctcag cagtcaccgc accggccctc ccccaatcag ccccagcaag aggaagttca 241 gcatggagcc aggtgacgag gacctagact gtgacaacga ccacgtctcc aaaatgagtc 301 gcatcttcaa cccccatctg aacaagactg ccaatggaga ctgccgcaga gacccccggg 361 agcggagccg cagccccatc gagcgcgctg tggcccccac catgagcctg cacggcagcc 421 acctgtacac ctccctcccc agccttggcc tggagcagcc cctcgcactg accaagaaca 481 gcctggacgc cagcaggcca gccggcctct cgcccacact gaccccgggg gagcggcagc 541 agaaccggcc ctccgtgatc acctgtgcct cggctggcgc ccgcaactgc aacctctcgc 601 actgccccat cgcgcacagc ggctgtgccg cgcccgggcc TGCCAGCTAC CGGAGGCCAC 661 CGAGCGCTGC CACCACCTGT GACCCCGTGG TGGAGGAGCA TTTCCGCAGG AGCCTGGGCA 721 AGAATTACAA GGAGCCCGAG CCGGCACCCA ACTCCGTGTC CATCACGGGC TCCGTGGACG 781 ACCACTTTGC CAAAGCTCTG GGTGACACGT GGCTCCAGAT CAAAGCGGCC AAGGACGGAG 841 CATCCAGCAG CCCTGAGTCC GCCTCTCGCA GGGGCCAGCC CGCCAGCCCC TCTGCCCACA 901 TGGTCAGCCA CAGTCACTCC CCCTCTGTGG TCTCCTGCCC AACTTTCTTG TACAAAGTGG 961 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1021 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1081 ATATGCCTAT GACTCGCAAG TTGCGACGCG TTAAGTCgac aatcaacctc tggattacaa 1141 aatttgtgaa agatt