Transcript: Human NM_178003.3

Homo sapiens protein phosphatase 2 phosphatase activator (PTPA), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
PTPA (5524)
Length:
2514
CDS:
187..1032

Additional Resources:

NCBI RefSeq record:
NM_178003.3
NBCI Gene record:
PTPA (5524)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001121 CATACGCTGACTACATCGGAT pLKO.1 317 CDS 100% 2.640 3.696 N PTPA n/a
2 TRCN0000349491 CATACGCTGACTACATCGGAT pLKO_005 317 CDS 100% 2.640 3.696 N PTPA n/a
3 TRCN0000380810 TGGATGACCAAATAGCTATTG pLKO_005 581 CDS 100% 10.800 7.560 N PTPA n/a
4 TRCN0000001118 CCGTTTGATGAGAGGCTGTTT pLKO.1 1129 3UTR 100% 4.950 3.465 N PTPA n/a
5 TRCN0000001119 GATCCACACAGTTCCAGACAT pLKO.1 273 CDS 100% 4.950 3.465 N PTPA n/a
6 TRCN0000318464 GATCCACACAGTTCCAGACAT pLKO_005 273 CDS 100% 4.950 3.465 N PTPA n/a
7 TRCN0000010597 GTGGATGAGAAGGCCGTGAAT pLKO.1 775 CDS 100% 4.950 3.465 N PTPA n/a
8 TRCN0000318472 GTGGATGAGAAGGCCGTGAAT pLKO_005 775 CDS 100% 4.950 3.465 N PTPA n/a
9 TRCN0000077224 GCTATTGTCTTCAAGGTGTTT pLKO.1 595 CDS 100% 4.950 3.465 N Ptpa n/a
10 TRCN0000301402 GCTATTGTCTTCAAGGTGTTT pLKO_005 595 CDS 100% 4.950 3.465 N Ptpa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01265 pDONR223 100% 86.9% 86.9% None 213_214ins126 n/a
2 ccsbBroad304_01265 pLX_304 0% 86.9% 86.9% V5 213_214ins126 n/a
3 TRCN0000468284 GACTCTCTTGCGACAAAGACAAAT pLX_317 36.1% 86.9% 86.9% V5 213_214ins126 n/a
Download CSV