Transcript: Human NM_178026.3

Homo sapiens gamma-glutamyltransferase 7 (GGT7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
GGT7 (2686)
Length:
2638
CDS:
42..2030

Additional Resources:

NCBI RefSeq record:
NM_178026.3
NBCI Gene record:
GGT7 (2686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021576 TGCTCAGTAAACAGGGATCTT pLKO.1 508 CDS 100% 4.950 3.960 N GGT7 n/a
2 TRCN0000434331 CAGCAATTACAGCGCCCTTGT pLKO_005 1094 CDS 100% 4.050 3.240 N GGT7 n/a
3 TRCN0000420179 ACCTTGAGGAATCAGACTATC pLKO_005 2281 3UTR 100% 10.800 7.560 N GGT7 n/a
4 TRCN0000418129 GAGACCCTGAAGATTGCATTA pLKO_005 1269 CDS 100% 10.800 7.560 N GGT7 n/a
5 TRCN0000423225 TGGGACCTGATGACTTCATTG pLKO_005 1477 CDS 100% 10.800 7.560 N GGT7 n/a
6 TRCN0000433945 GAGATCCCGTCTATGATTCTA pLKO_005 1309 CDS 100% 5.625 3.938 N GGT7 n/a
7 TRCN0000429145 CGTGATGCTGGTACATGACAT pLKO_005 605 CDS 100% 4.950 3.465 N GGT7 n/a
8 TRCN0000021577 GACGAAATGAGAGCCACCTAA pLKO.1 628 CDS 100% 4.950 3.465 N GGT7 n/a
9 TRCN0000021578 GCCAGTGGACTACATGAGCAT pLKO.1 92 CDS 100% 2.640 1.848 N GGT7 n/a
10 TRCN0000432029 CTTAGGGATGTGCTTGCAAAC pLKO_005 2346 3UTR 100% 6.000 3.600 N GGT7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06271 pDONR223 100% 99.6% 99.5% None (many diffs) n/a
2 ccsbBroad304_06271 pLX_304 0% 99.6% 99.5% V5 (many diffs) n/a
3 TRCN0000478008 CCGTACTCACTGTCGTTAAACCCA pLX_317 11.8% 99.6% 99.5% V5 (many diffs) n/a
Download CSV