Construct: ORF TRCN0000478008
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012222.1_s317c1
- Derived from:
- ccsbBroadEn_06271
- DNA Barcode:
- CCGTACTCACTGTCGTTAAACCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GGT7 (2686)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478008
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | NM_178026.3 | 99.6% | 99.5% | (many diffs) |
| 2 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | NM_001351702.1 | 94.2% | 91.5% | (many diffs) |
| 3 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | XM_017027810.2 | 88.5% | 87.4% | (many diffs) |
| 4 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | XR_001754240.1 | 86.4% | (many diffs) | |
| 5 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | XR_001754244.1 | 84.5% | (many diffs) | |
| 6 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | XR_001754243.1 | 83.5% | (many diffs) | |
| 7 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | XR_001754242.1 | 81% | (many diffs) | |
| 8 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | XM_017027811.1 | 79.8% | 79.6% | (many diffs) |
| 9 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | XM_011528782.2 | 64.6% | 64.6% | 0_1ins702;816C>A |
| 10 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | XM_024451871.1 | 64.6% | 64.6% | 0_1ins702;816C>A |
| 11 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | XR_001754241.1 | 64% | (many diffs) | |
| 12 | human | 2686 | GGT7 | gamma-glutamyltransferase 7 | XM_011528783.3 | 57.2% | 57.2% | 0_1ins849;669C>A |
| 13 | mouse | 207182 | Ggt7 | gamma-glutamyltransferase 7 | NM_144786.2 | 89.7% | 95.7% | (many diffs) |
| 14 | mouse | 207182 | Ggt7 | gamma-glutamyltransferase 7 | XM_011239400.2 | 89.2% | 95.1% | (many diffs) |
| 15 | mouse | 207182 | Ggt7 | gamma-glutamyltransferase 7 | XM_006499060.2 | 87.3% | 92.4% | (many diffs) |
| 16 | mouse | 207182 | Ggt7 | gamma-glutamyltransferase 7 | XM_011239401.1 | 63.9% | 67.7% | (many diffs) |
| 17 | mouse | 207182 | Ggt7 | gamma-glutamyltransferase 7 | XM_006499061.3 | 58.1% | 61.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2055
- ORF length:
- 1986
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcggcggag aacgaggcca gccaggagag cgccctgggc gcctactcgc 121 cagtggacta catgagcatc accagcttac cgcggctgcc cgaggacgag ccggcgcccg 181 cggccccgct gaggggccgc aaggacgagg acgccttcct gggagacccc gacaccgacc 241 cggactcctt cctgaagtct gcacggctgc agcggctgcc atcgtcgtcg tcggagatgg 301 gcagccaaga cgggtcaccg ctacgcgaga cgcgcaaaga cccgttctcc gccgcagcgg 361 ccgagtgctc ctgccgccag gatgggctca cggtcatcgt cacggcctgt ctcaccttcg 421 ctaccggtgt caccgtggcg ctggtcatgc agatctactt cggggacccc cagatcttcc 481 agcagggtgc cgtggtgacc gatgctgccc gctgcacttc actgggcatc gaggtgctca 541 gtaaacaggg atcttctgtg gacgcagcgg tggcagtagc cttgtgtttg ggtatcgtgg 601 ctccacacag ttctggcctg ggcggtgggg gcgtgatgct ggtacatgtc atccgacgaa 661 atgagagcca cctaattgat ttccgggagt ccgcaccagg ggccctcagg gaagagaccc 721 tgcaaagatc ctgggagacc aagcctgggc tcttggtggg ggttcccgga atggtgaagg 781 ggctacatga agctcaccag ctctatggca ggctgccatg gtcccaagtc ctggcctttg 841 cagcagctgt ggcccaagat ggcttcaacg tgactcatga tctagcccgt gccctggctg 901 aacagctgcc acccaacatg tccgagcgct tccgggagac gttcctgcca tcgggccgcc 961 cgccactacc tggctcgttg ctgcatcggc ccgacctggc tgaggtgctg gatgtacttg 1021 gcacctccgg cccggctgcc ttctacgcag gtggcaacct cacactggag atggtggccg 1081 aggctcagca cgcagggggt gtcataaccg aagaggactt cagcaattac agcgcccttg 1141 tggagaagcc tgtgtgtggc gtgtacagag gccacctggt tcttagtccc ccacctccgc 1201 acacgggccc tgccctcatc agtgctctca acatcctgga gggcttcaat ctcaccagcc 1261 tggtatcccg agaacaggct cttcactggg tggcagagac cctgaagatt gcattagccc 1321 tggccagcag actgggagat cccgtctatg attctaccat cactgagagc atggatgaca 1381 tgctcagcaa ggtggaggcc gcctacctcc ggggccatat caatgactcc caggcagccc 1441 ctgccccact cctgcctgtc tatgaactag acggagctcc cacggctgcc caggtgctga 1501 tcatgggacc tgatgacttc attgtggcca tggttagctc cctgaaccag ccctttggca 1561 gcggccttat caccccctcg gggatactgc tcaacagcca gatgctggac ttctcctggc 1621 ccaaccggac agctaaccac tctgcaccca gcctggagaa ttcagtgcag ccagggaagc 1681 ggccactctc tttcctgctg cccacagtgg tccgacccgc ggaggggctc tgtggaacct 1741 acctcgctct gggggccaat ggagctgcgc ggggcctcag cggcctgaca caggttctgc 1801 tgaatgtcct gaccttgaac cggaaccTGA GTGACAGCCT GGCCCGCGGC CGCCTACACC 1861 CGGACCTGCA GTCCAACCTC CTGCAGGTGG ACAGTGAGTT CACAGAGGAA GAGATTGAGT 1921 TCCTGGAAGC CAGGGGTCAC CACGTGGAGA AAGTAGATGT CTTATCCTGG GTCCATGGCA 1981 GCCGAAGGAC CAACAACTTC ATCATCGCTG TTAAGGACCC TCGGAGCCCA GATGCAGCTG 2041 GAGCCACCAT CCTGTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 2101 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCATAA CTTGAAAGTA 2161 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CCGTACTCAC TGTCGTTAAA 2221 CCCAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt