Transcript: Human NM_178033.2

Homo sapiens cytochrome P450 family 4 subfamily X member 1 (CYP4X1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CYP4X1 (260293)
Length:
2256
CDS:
150..1679

Additional Resources:

NCBI RefSeq record:
NM_178033.2
NBCI Gene record:
CYP4X1 (260293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178033.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418219 ACAATGATTAAACGTACTTTG pLKO_005 1690 3UTR 100% 10.800 15.120 N CYP4X1 n/a
2 TRCN0000064074 GCACCCATGATCCTTATGCAA pLKO.1 769 CDS 100% 3.000 4.200 N CYP4X1 n/a
3 TRCN0000064073 GCCATGATTGAGTTAAAGGTA pLKO.1 1527 CDS 100% 3.000 4.200 N CYP4X1 n/a
4 TRCN0000064077 CACCAGAAGTTTATTCAGGAT pLKO.1 318 CDS 100% 2.640 2.112 N CYP4X1 n/a
5 TRCN0000064075 GCCCAAGAATGGGATGTATTT pLKO.1 1631 CDS 100% 13.200 9.240 N CYP4X1 n/a
6 TRCN0000064076 GCTGGATAAGTGGGAGAAGAT pLKO.1 638 CDS 100% 4.950 3.465 N CYP4X1 n/a
7 TRCN0000417251 TTGTATCACAGTGACATAATT pLKO_005 840 CDS 100% 15.000 9.000 N CYP4X1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178033.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05330 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05330 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471634 GGTAGGAACTCCTGGCAATTTATA pLX_317 30.9% 100% 100% V5 n/a
Download CSV