Transcript: Human NM_178136.3

Homo sapiens DNA polymerase delta interacting protein 3 (POLDIP3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
POLDIP3 (84271)
Length:
3275
CDS:
27..1205

Additional Resources:

NCBI RefSeq record:
NM_178136.3
NBCI Gene record:
POLDIP3 (84271)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178136.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312737 ACGATGCCATCACCGCATATA pLKO_005 913 CDS 100% 13.200 18.480 N POLDIP3 n/a
2 TRCN0000312682 TTGCAGAAAGATGCCCGATTT pLKO_005 261 CDS 100% 10.800 15.120 N POLDIP3 n/a
3 TRCN0000052932 CCCTTCCTCTATTCGAACAAA pLKO.1 662 CDS 100% 5.625 7.875 N POLDIP3 n/a
4 TRCN0000327892 CCCTTCCTCTATTCGAACAAA pLKO_005 662 CDS 100% 5.625 7.875 N POLDIP3 n/a
5 TRCN0000052928 CGCATATAAGAAGTACAACAA pLKO.1 926 CDS 100% 4.950 3.960 N POLDIP3 n/a
6 TRCN0000370587 GTGCTCTTCTCTCTACGTTAA pLKO_005 1382 3UTR 100% 10.800 7.560 N POLDIP3 n/a
7 TRCN0000052929 CCTACTAAACAGATGAAGTTT pLKO.1 522 CDS 100% 5.625 3.938 N POLDIP3 n/a
8 TRCN0000052930 GCCTTCATAAACCCACCCATT pLKO.1 414 CDS 100% 4.050 2.835 N POLDIP3 n/a
9 TRCN0000312683 ATGAAGATGATGATGGTATAG pLKO_005 493 CDS 100% 10.800 6.480 N POLDIP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178136.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12800 pDONR223 100% 57.6% 58% None (many diffs) n/a
2 ccsbBroad304_12800 pLX_304 0% 57.6% 58% V5 (many diffs) n/a
3 TRCN0000491529 ACTGGCAGGTAGTGCTAAAGGATT pLX_317 62.5% 57.6% 58% V5 (many diffs) n/a
Download CSV