Transcript: Human NM_178181.2

Homo sapiens CUB domain containing protein 1 (CDCP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
CDCP1 (64866)
Length:
1416
CDS:
136..1167

Additional Resources:

NCBI RefSeq record:
NM_178181.2
NBCI Gene record:
CDCP1 (64866)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136763 CATTGCAAACCGCTCATCTAT pLKO.1 765 CDS 100% 5.625 7.875 N CDCP1 n/a
2 TRCN0000137994 GCATTGCAAACCGCTCATCTA pLKO.1 764 CDS 100% 4.950 6.930 N CDCP1 n/a
3 TRCN0000134182 CTTTGTCATAGAGATCCAGAA pLKO.1 399 CDS 100% 4.050 5.670 N CDCP1 n/a
4 TRCN0000137203 GCTCATAAGAGCATCGGTTTA pLKO.1 526 CDS 100% 10.800 7.560 N CDCP1 n/a
5 TRCN0000136536 CCATCAAGTCTGGAGAAAGAA pLKO.1 341 CDS 100% 5.625 3.938 N CDCP1 n/a
6 TRCN0000134829 CCTGAGAATCACTTTGTCATA pLKO.1 388 CDS 100% 4.950 3.465 N CDCP1 n/a
7 TRCN0000138424 CGTCTCCTTCCTCAACTTCAA pLKO.1 924 CDS 100% 4.950 3.465 N CDCP1 n/a
8 TRCN0000138566 CGGATCAAGATGCAAGAAGGA pLKO.1 688 CDS 100% 2.640 1.848 N CDCP1 n/a
9 TRCN0000137839 GCCTACCCTCAACAGAACTTT pLKO.1 489 CDS 100% 5.625 3.375 N CDCP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178181.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03981 pDONR223 99.1% 100% 100% None n/a
2 ccsbBroad304_03981 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472057 ACCTGTGAGTGTGGATATTGGGTA pLX_317 31.1% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV