Transcript: Mouse NM_178253.5

Mus musculus kelch domain containing 1 (Klhdc1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Klhdc1 (271005)
Length:
1949
CDS:
87..1307

Additional Resources:

NCBI RefSeq record:
NM_178253.5
NBCI Gene record:
Klhdc1 (271005)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178253.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197592 CTGTAATACAACTGTGGACAT pLKO.1 1620 3UTR 100% 4.050 5.670 N Klhdc1 n/a
2 TRCN0000176579 CTACGTGTCTATTGAAGACAA pLKO.1 176 CDS 100% 0.495 0.693 N Klhdc1 n/a
3 TRCN0000197694 GTTGGAAACAACTTAGACATT pLKO.1 943 CDS 100% 4.950 3.960 N Klhdc1 n/a
4 TRCN0000176648 CGGCTTTACTTTGTCAATTTA pLKO.1 369 CDS 100% 15.000 10.500 N Klhdc1 n/a
5 TRCN0000216374 GAATGACCTACACTATCTAAA pLKO.1 749 CDS 100% 13.200 9.240 N Klhdc1 n/a
6 TRCN0000216358 GAAATAAGGGTTACGTCTTTG pLKO.1 703 CDS 100% 10.800 7.560 N Klhdc1 n/a
7 TRCN0000176522 CGATGTATCTGTGTGTTTGTT pLKO.1 1461 3UTR 100% 5.625 3.938 N Klhdc1 n/a
8 TRCN0000176830 GATACAGGTCACTGTAATGAT pLKO.1 1062 CDS 100% 0.563 0.394 N Klhdc1 n/a
9 TRCN0000177422 GAAAGACAGAAATAGCTCTAA pLKO.1 1585 3UTR 100% 4.950 2.970 N Klhdc1 n/a
10 TRCN0000143098 CTTGGATACAGGTCACTGTAA pLKO.1 1058 CDS 100% 0.495 0.297 N KLHDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178253.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09473 pDONR223 100% 88.3% 19.9% None (many diffs) n/a
2 ccsbBroad304_09473 pLX_304 0% 88.3% 19.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476132 GGGACGTCCTCTAATCATGACTCG pLX_317 19.9% 88.3% 19.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV