Transcript: Mouse NM_178263.3

Mus musculus ankyrin repeat domain 27 (VPS9 domain) (Ankrd27), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ankrd27 (245886)
Length:
1929
CDS:
153..1286

Additional Resources:

NCBI RefSeq record:
NM_178263.3
NBCI Gene record:
Ankrd27 (245886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178263.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248745 GTATGTCCATCACGATATTTA pLKO_005 794 CDS 100% 15.000 21.000 N Ankrd27 n/a
2 TRCN0000248744 ACCACATAGACTCCGTAAATG pLKO_005 670 CDS 100% 13.200 18.480 N Ankrd27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178263.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04327 pDONR223 100% 30.7% 32.2% None (many diffs) n/a
2 ccsbBroad304_04327 pLX_304 0% 30.7% 32.2% V5 (many diffs) n/a
3 TRCN0000472417 CCCCGGTGAGCGGCCGACGTAAAT pLX_317 14.4% 30.7% 32.2% V5 (many diffs) n/a
Download CSV