Transcript: Human NM_178276.7

Homo sapiens serine incorporator 5 (SERINC5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SERINC5 (256987)
Length:
1905
CDS:
127..1398

Additional Resources:

NCBI RefSeq record:
NM_178276.7
NBCI Gene record:
SERINC5 (256987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178276.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166588 CTGCCGTGTATAGAGTCTGTT pLKO.1 392 CDS 100% 4.950 6.930 N SERINC5 n/a
2 TRCN0000159688 GCTTATATCATTGGTAGCCAT pLKO.1 849 CDS 100% 2.640 3.696 N SERINC5 n/a
3 TRCN0000422622 GTAGAGCTCATATTCACAATG pLKO_005 479 CDS 100% 10.800 8.640 N SERINC5 n/a
4 TRCN0000426351 GAGGGACCACGGGTCATTTAT pLKO_005 1246 CDS 100% 15.000 10.500 N SERINC5 n/a
5 TRCN0000433456 CCGTGGCTCACAAGATGAAAG pLKO_005 296 CDS 100% 10.800 7.560 N SERINC5 n/a
6 TRCN0000166329 CCAGCCTCTTAATCGGATGTA pLKO.1 1079 CDS 100% 4.950 3.465 N SERINC5 n/a
7 TRCN0000165901 GCAGCTCCTGAATTGGAGATA pLKO.1 1162 CDS 100% 4.950 3.465 N SERINC5 n/a
8 TRCN0000165143 GCCATGTGGAACTCTGAGAAA pLKO.1 1415 3UTR 100% 4.950 3.465 N SERINC5 n/a
9 TRCN0000119354 GTTTGCACATAAGTGGAACAA pLKO.1 651 CDS 100% 4.950 3.465 N Serinc5 n/a
10 TRCN0000166587 CACCGTCTACATCTACTCCTA pLKO.1 1281 CDS 100% 2.640 1.848 N SERINC5 n/a
11 TRCN0000159382 GCACATCAAAGAATGCAATTA pLKO.1 1534 3UTR 100% 13.200 7.920 N SERINC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178276.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.