Transcript: Mouse NM_178397.3

Mus musculus Fas associated factor family member 2 (Faf2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Faf2 (76577)
Length:
4322
CDS:
58..1395

Additional Resources:

NCBI RefSeq record:
NM_178397.3
NBCI Gene record:
Faf2 (76577)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178397.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191263 CGGTTTACCTATTACACGATA pLKO.1 367 CDS 100% 4.950 6.930 N Faf2 n/a
2 TRCN0000189633 CCTTGCTTTGGAGCAGCATAA pLKO.1 156 CDS 100% 10.800 8.640 N Faf2 n/a
3 TRCN0000200596 CCCACAGTTTATGAATAACTT pLKO.1 1794 3UTR 100% 5.625 3.938 N Faf2 n/a
4 TRCN0000189634 CCACAGGATCTACAGCTATGT pLKO.1 282 CDS 100% 4.950 3.465 N Faf2 n/a
5 TRCN0000200535 CCTCTTAATCTCTTTCTGTAA pLKO.1 3165 3UTR 100% 4.950 3.465 N Faf2 n/a
6 TRCN0000004407 GCTTCCATTCCGGTTTACCTA pLKO.1 357 CDS 100% 3.000 2.100 N FAF2 n/a
7 TRCN0000273433 GCTTCCATTCCGGTTTACCTA pLKO_005 357 CDS 100% 3.000 2.100 N FAF2 n/a
8 TRCN0000191032 CCATGACTTCTTATTCTCCTT pLKO.1 1218 CDS 100% 2.640 1.848 N Faf2 n/a
9 TRCN0000189602 CCTGTGTTCCTTCAGAGGAAT pLKO.1 1295 CDS 100% 0.495 0.347 N Faf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178397.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02735 pDONR223 100% 90.4% 97.7% None (many diffs) n/a
2 ccsbBroad304_02735 pLX_304 0% 90.4% 97.7% V5 (many diffs) n/a
3 TRCN0000477478 AGACCTCGAGCGATCGCGGAACCC pLX_317 32.7% 90.4% 97.7% V5 (many diffs) n/a
Download CSV