Transcript: Human NM_178491.3

Homo sapiens R3H domain containing like (R3HDML), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
R3HDML (140902)
Length:
762
CDS:
1..762

Additional Resources:

NCBI RefSeq record:
NM_178491.3
NBCI Gene record:
R3HDML (140902)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178491.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165882 GCATACCTGGTCTGCAACTAT pLKO.1 601 CDS 100% 5.625 7.875 N R3HDML n/a
2 TRCN0000165658 GTCTGAGGAGAAGTGGCATTA pLKO.1 414 CDS 100% 10.800 8.640 N R3HDML n/a
3 TRCN0000166330 CAGAACCTCTCCATCCATTCT pLKO.1 355 CDS 100% 4.950 3.465 N R3HDML n/a
4 TRCN0000165881 GCCTTCACAGCTGATGAGATA pLKO.1 327 CDS 100% 4.950 3.465 N R3HDML n/a
5 TRCN0000166478 CTGGTCTGCAACTATGCCATT pLKO.1 607 CDS 100% 4.050 2.835 N R3HDML n/a
6 TRCN0000161517 GAACGCCTTGATAATGCCTAA pLKO.1 63 CDS 100% 4.050 2.835 N R3HDML n/a
7 TRCN0000160866 GTGAGAGACATGAATGCCTTA pLKO.1 178 CDS 100% 4.050 2.835 N R3HDML n/a
8 TRCN0000162013 GCCTTGATAATGCCTAATGCT pLKO.1 67 CDS 100% 3.000 2.100 N R3HDML n/a
9 TRCN0000165657 GATCTCATGAAGTCCTGGTCT pLKO.1 397 CDS 100% 2.640 1.848 N R3HDML n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178491.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04958 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04958 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472890 AAGAAGTGAAGCACGCGCTTGAAT pLX_317 19.4% 100% 100% V5 n/a
Download CSV