Transcript: Human NM_178557.4

Homo sapiens N-acetyltransferase 8 like (NAT8L), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
NAT8L (339983)
Length:
6056
CDS:
186..1094

Additional Resources:

NCBI RefSeq record:
NM_178557.4
NBCI Gene record:
NAT8L (339983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178557.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437303 GTGGGTTGTTTGTCGCCATAG pLKO_005 1287 3UTR 100% 6.000 8.400 N NAT8L n/a
2 TRCN0000437657 CGGACATCGAGCAGTACTACA pLKO_005 694 CDS 100% 4.950 6.930 N NAT8L n/a
3 TRCN0000147770 GCATGACTTTAATTCTTGGGA pLKO.1 2059 3UTR 100% 0.750 1.050 N NAT8L n/a
4 TRCN0000146484 CCTGATTGGATGTCATTTCCT pLKO.1 2184 3UTR 100% 3.000 2.400 N NAT8L n/a
5 TRCN0000148647 CAGCCTGAAACCAACACATTT pLKO.1 2006 3UTR 100% 13.200 9.240 N NAT8L n/a
6 TRCN0000149334 GAAACCCTGATTGGATGTCAT pLKO.1 2179 3UTR 100% 4.950 3.465 N NAT8L n/a
7 TRCN0000147267 GCAGGAGAAGAATAAACACTT pLKO.1 2487 3UTR 100% 4.950 3.465 N NAT8L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178557.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13594 pDONR223 100% 44.3% 44.3% None 1_504del n/a
2 ccsbBroad304_13594 pLX_304 0% 44.3% 44.3% V5 1_504del n/a
3 TRCN0000477780 ACAACTCCCAGCCCAATATCGACC pLX_317 87.2% 44.3% 44.3% V5 1_504del n/a
Download CSV