Transcript: Human NM_178568.4

Homo sapiens reticulon 4 receptor like 1 (RTN4RL1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RTN4RL1 (146760)
Length:
3614
CDS:
470..1795

Additional Resources:

NCBI RefSeq record:
NM_178568.4
NBCI Gene record:
RTN4RL1 (146760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178568.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060594 GAACCGCAATCAGATCTCTAA pLKO.1 1549 CDS 100% 4.950 6.930 N RTN4RL1 n/a
2 TRCN0000060593 GTGGATCTACTCGAACAACAT pLKO.1 712 CDS 100% 4.950 6.930 N RTN4RL1 n/a
3 TRCN0000434931 TGGTGAACCTGGACCGTCTTT pLKO_005 1056 CDS 100% 4.950 6.930 N RTN4RL1 n/a
4 TRCN0000414152 AGTACCTCCAGGACGACATCT pLKO_005 954 CDS 100% 4.950 3.465 N RTN4RL1 n/a
5 TRCN0000060595 CTACTCGAACAACATCACCTA pLKO.1 718 CDS 100% 2.640 1.848 N RTN4RL1 n/a
6 TRCN0000060596 CCAGATCAAGTCACACACGCT pLKO.1 1402 CDS 100% 0.660 0.462 N RTN4RL1 n/a
7 TRCN0000060597 CCACCTGTTTCTCCACGGCAA pLKO.1 997 CDS 100% 0.720 0.432 N RTN4RL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178568.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09632 pDONR223 100% 99.8% 100% None 648G>A;759C>T n/a
2 ccsbBroad304_09632 pLX_304 0% 99.8% 100% V5 648G>A;759C>T n/a
3 TRCN0000477012 CCAGTATTGGACAGCTTTCAGGAC pLX_317 30.7% 99.8% 100% V5 648G>A;759C>T n/a
Download CSV