Transcript: Mouse NM_178607.4

Mus musculus ring finger protein 24 (Rnf24), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rnf24 (51902)
Length:
5594
CDS:
165..611

Additional Resources:

NCBI RefSeq record:
NM_178607.4
NBCI Gene record:
Rnf24 (51902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178607.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041160 CCACAGAAAGTGCCTTGTTAA pLKO.1 464 CDS 100% 13.200 18.480 N Rnf24 n/a
2 TRCN0000004255 GTTTACTCTTCTGTTGCTACT pLKO.1 280 CDS 100% 4.050 3.240 N RNF24 n/a
3 TRCN0000041159 GCCTACAAACAGGTTATATTA pLKO.1 339 CDS 100% 15.000 10.500 N Rnf24 n/a
4 TRCN0000041158 CCACTCTTAATGTGATTTCTT pLKO.1 2824 3UTR 100% 5.625 3.938 N Rnf24 n/a
5 TRCN0000041161 GCCTAGAGATGAACTGGGTAT pLKO.1 422 CDS 100% 4.050 2.835 N Rnf24 n/a
6 TRCN0000041162 GCTGTGTTTGTCTTCATCCTT pLKO.1 258 CDS 100% 3.000 1.800 N Rnf24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178607.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02655 pDONR223 100% 92.5% 97.9% None (many diffs) n/a
2 ccsbBroad304_02655 pLX_304 0% 92.5% 97.9% V5 (many diffs) n/a
3 TRCN0000472407 GGCTATGTTATACTTACGATCTGT pLX_317 89.8% 92.5% 97.9% V5 (many diffs) n/a
Download CSV