Transcript: Mouse NM_178613.3

Mus musculus GSK3B interacting protein (Gskip), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Gskip (66787)
Length:
2787
CDS:
94..528

Additional Resources:

NCBI RefSeq record:
NM_178613.3
NBCI Gene record:
Gskip (66787)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178613.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264807 CCGGTGTTTATAAACGTAATA pLKO_005 1616 3UTR 100% 13.200 18.480 N Gskip n/a
2 TRCN0000215795 CTGGTATAGAATCTAACATAA pLKO.1 563 3UTR 100% 13.200 18.480 N Gskip n/a
3 TRCN0000192865 GAGGCAGTTGTAAACGATGTA pLKO.1 220 CDS 100% 4.950 6.930 N Gskip n/a
4 TRCN0000191662 GTTGTAAACGATGTACTCTTT pLKO.1 226 CDS 100% 4.950 6.930 N Gskip n/a
5 TRCN0000264806 TGACCAGGTGGAGGATCATTT pLKO_005 384 CDS 100% 13.200 9.240 N Gskip n/a
6 TRCN0000264808 TGGGTTTGAAGGAGCGGATAT pLKO_005 177 CDS 100% 10.800 7.560 N Gskip n/a
7 TRCN0000202134 CCATGAGACAGTCTACTCCTT pLKO.1 417 CDS 100% 2.640 1.848 N Gskip n/a
8 TRCN0000283187 TAAGCAGTATGTCTGGATTTG pLKO_005 137 CDS 100% 10.800 6.480 N Gskip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178613.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03327 pDONR223 100% 84.7% 90.2% None (many diffs) n/a
2 ccsbBroad304_03327 pLX_304 0% 84.7% 90.2% V5 (many diffs) n/a
3 TRCN0000469265 CGACTAACGGGTATCTCCCGGTTG pLX_317 80.7% 84.7% 90.2% V5 (many diffs) n/a
Download CSV