Transcript: Mouse NM_178615.4

Mus musculus repulsive guidance molecule family member B (Rgmb), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Mus musculus (mouse)
Gene:
Rgmb (68799)
Length:
4205
CDS:
411..1721

Additional Resources:

NCBI RefSeq record:
NM_178615.4
NBCI Gene record:
Rgmb (68799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178615.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193667 CTATTTCCAATCGTGTGTCTT pLKO.1 1520 CDS 100% 4.950 3.960 N Rgmb n/a
2 TRCN0000175836 GACAACAATTACCTTTCGGTT pLKO.1 990 CDS 100% 2.640 2.112 N Rgmb n/a
3 TRCN0000370437 CCACTGGTGATGCCAACTTTA pLKO_005 1552 CDS 100% 13.200 9.240 N RGMB n/a
4 TRCN0000173925 GCTGTGTTAGGCATCAGTGAT pLKO.1 741 CDS 100% 4.950 3.465 N Rgmb n/a
5 TRCN0000173187 CCTTCGAACTTTCAAGGATCA pLKO.1 929 CDS 100% 4.050 2.835 N Rgmb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178615.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09984 pDONR223 100% 79.5% 81.2% None (many diffs) n/a
2 ccsbBroad304_09984 pLX_304 0% 79.5% 81.2% V5 (many diffs) n/a
3 TRCN0000477953 TTTCAAATGTTACTTCTATTTTGT pLX_317 28.8% 79.5% 81.2% V5 (many diffs) n/a
Download CSV