Transcript: Mouse NM_178647.2

Mus musculus CGG triplet repeat binding protein 1 (Cggbp1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cggbp1 (106143)
Length:
4382
CDS:
402..905

Additional Resources:

NCBI RefSeq record:
NM_178647.2
NBCI Gene record:
Cggbp1 (106143)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178647.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125744 GCCCAGCAATAATTTGTGTTT pLKO.1 2433 3UTR 100% 4.950 6.930 N Cggbp1 n/a
2 TRCN0000125748 CATGTTCGCAAGTCTGCCATT pLKO.1 555 CDS 100% 4.050 5.670 N Cggbp1 n/a
3 TRCN0000125745 AGCCAGTGTTATCCAGGACTT pLKO.1 701 CDS 100% 4.050 2.835 N Cggbp1 n/a
4 TRCN0000125746 CCACCTCAAGTCAAAGACTCA pLKO.1 581 CDS 100% 2.640 1.848 N Cggbp1 n/a
5 TRCN0000125747 GAAATCGTTCTAAGACTGCTT pLKO.1 436 CDS 100% 2.640 1.848 N Cggbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178647.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01950 pDONR223 100% 91.6% 98.2% None (many diffs) n/a
2 ccsbBroad304_01950 pLX_304 0% 91.6% 98.2% V5 (many diffs) n/a
3 TRCN0000466733 ATCGATACCGAATTCTCCGGACTG pLX_317 80.9% 91.6% 98.2% V5 (many diffs) n/a
Download CSV