Transcript: Mouse NM_178651.4

Mus musculus solute carrier family 30 (zinc transporter), member 9 (Slc30a9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Mus musculus (mouse)
Gene:
Slc30a9 (109108)
Length:
3410
CDS:
141..1844

Additional Resources:

NCBI RefSeq record:
NM_178651.4
NBCI Gene record:
Slc30a9 (109108)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178651.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375921 ATCCCTGCTATGGGCATATTG pLKO_005 1157 CDS 100% 13.200 18.480 N Slc30a9 n/a
2 TRCN0000079695 CCCGACATTCACCCACATTTA pLKO.1 288 CDS 100% 13.200 18.480 N Slc30a9 n/a
3 TRCN0000352093 CCCGACATTCACCCACATTTA pLKO_005 288 CDS 100% 13.200 18.480 N Slc30a9 n/a
4 TRCN0000079694 CCGAGTACAAATGTTATTCTA pLKO.1 1299 CDS 100% 5.625 7.875 N Slc30a9 n/a
5 TRCN0000079697 GACGAGTTGTTACGAGATCAT pLKO.1 1630 CDS 100% 4.950 6.930 N Slc30a9 n/a
6 TRCN0000352094 GACGAGTTGTTACGAGATCAT pLKO_005 1630 CDS 100% 4.950 6.930 N Slc30a9 n/a
7 TRCN0000079696 CGAGTTGTTACGAGATCATAT pLKO.1 1632 CDS 100% 13.200 10.560 N Slc30a9 n/a
8 TRCN0000375922 AGCTGTCTTAGGAGTGATAAT pLKO_005 1334 CDS 100% 13.200 9.240 N Slc30a9 n/a
9 TRCN0000079693 GCCTGTGTTGAACCATGAAAT pLKO.1 2062 3UTR 100% 13.200 9.240 N Slc30a9 n/a
10 TRCN0000352095 GCCTGTGTTGAACCATGAAAT pLKO_005 2062 3UTR 100% 13.200 9.240 N Slc30a9 n/a
11 TRCN0000019931 GCAGAACTCAAAGCTCCACTT pLKO.1 426 CDS 100% 4.050 2.430 N SLC30A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178651.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07614 pDONR223 100% 86.4% 88.9% None (many diffs) n/a
2 ccsbBroad304_07614 pLX_304 0% 86.4% 88.9% V5 (many diffs) n/a
Download CSV