Transcript: Mouse NM_178662.3

Mus musculus ataxia, cerebellar, Cayman type (Atcay), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Atcay (16467)
Length:
3677
CDS:
340..1458

Additional Resources:

NCBI RefSeq record:
NM_178662.3
NBCI Gene record:
Atcay (16467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184019 CGGAGCACATCGAAAGAGAAA pLKO.1 501 CDS 100% 4.950 6.930 N Atcay n/a
2 TRCN0000184409 CTGGTTCATTCGCACTGTGTT pLKO.1 1161 CDS 100% 4.950 3.960 N Atcay n/a
3 TRCN0000183930 CTGTGGCGAACTGTCATCATA pLKO.1 796 CDS 100% 5.625 3.938 N Atcay n/a
4 TRCN0000179328 GCTGAAGAAGTGTTACCACAT pLKO.1 1086 CDS 100% 4.050 2.835 N Atcay n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04475 pDONR223 100% 83.5% 91.1% None (many diffs) n/a
2 ccsbBroad304_04475 pLX_304 0% 83.5% 91.1% V5 (many diffs) n/a
3 TRCN0000472006 TAGTACCAAAAGCTTAACAGCGTT pLX_317 36.8% 83.5% 91.1% V5 (many diffs) n/a
Download CSV