Transcript: Mouse NM_178667.4

Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tfdp2 (211586)
Length:
7384
CDS:
552..1709

Additional Resources:

NCBI RefSeq record:
NM_178667.4
NBCI Gene record:
Tfdp2 (211586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178667.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095783 GAACATTAGACGAAGAGTTTA pLKO.1 902 CDS 100% 13.200 18.480 N Tfdp2 n/a
2 TRCN0000413300 GAGGCGGATAGAACGGATAAA pLKO_005 1043 CDS 100% 13.200 18.480 N TFDP2 n/a
3 TRCN0000095780 CCCTGTTCATTCAACGATGAA pLKO.1 1647 CDS 100% 0.495 0.693 N Tfdp2 n/a
4 TRCN0000095782 CCACAGGACCTTCTTGGTTAA pLKO.1 1426 CDS 100% 10.800 7.560 N Tfdp2 n/a
5 TRCN0000019920 CGAAGAGTTTATGATGCTTTA pLKO.1 912 CDS 100% 10.800 7.560 N TFDP2 n/a
6 TRCN0000420624 GAACTCTACCCAATCAGTTTC pLKO_005 1463 CDS 100% 10.800 7.560 N TFDP2 n/a
7 TRCN0000095779 GCTGAGATGATTGAACTGAAA pLKO.1 1862 3UTR 100% 4.950 3.465 N Tfdp2 n/a
8 TRCN0000095781 CCTACCAATTCTGCTCAGGAA pLKO.1 996 CDS 100% 2.640 1.848 N Tfdp2 n/a
9 TRCN0000092881 GAGGAAGATGAAGAGGAGGAA pLKO.1 1671 CDS 100% 2.640 1.320 Y Gm4169 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178667.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01662 pDONR223 100% 91.7% 95.3% None (many diffs) n/a
2 ccsbBroad304_01662 pLX_304 0% 91.7% 95.3% V5 (many diffs) n/a
3 TRCN0000473496 ATCACGGCATTTAAGGAGTGGGGT pLX_317 45.4% 91.7% 95.3% V5 (many diffs) n/a
Download CSV