Transcript: Mouse NM_178691.4

Mus musculus YOD1 deubiquitinase (Yod1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Yod1 (226418)
Length:
3843
CDS:
158..1189

Additional Resources:

NCBI RefSeq record:
NM_178691.4
NBCI Gene record:
Yod1 (226418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178691.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113324 CGAGATCTCAATCCTGTCTAA pLKO.1 811 CDS 100% 4.950 6.930 N Yod1 n/a
2 TRCN0000113323 CAAGTGATCCAGTCTTGTATA pLKO.1 714 CDS 100% 13.200 10.560 N Yod1 n/a
3 TRCN0000113321 GCACAAATTGTAGCAAGTGAT pLKO.1 701 CDS 100% 4.950 3.960 N Yod1 n/a
4 TRCN0000113320 GCACCGTATTTATAGAGCTTA pLKO.1 3204 3UTR 100% 4.950 3.960 N Yod1 n/a
5 TRCN0000113322 GCTCCTAGTTATGTCAGGGAA pLKO.1 554 CDS 100% 2.640 1.848 N Yod1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178691.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03590 pDONR223 100% 86.8% 87.3% None (many diffs) n/a
2 ccsbBroad304_03590 pLX_304 0% 86.8% 87.3% V5 (many diffs) n/a
3 TRCN0000477825 TCTCACAATACACAGCTGCCCCCG pLX_317 41% 86.8% 87.3% V5 (many diffs) n/a
Download CSV